Dicer, Drosha i wyniki u pacjentów z rakiem jajnika cd

Ilościowy RT-PCR przeprowadzono za pomocą zestawu do oznaczania ekspresji genu TaąMan (Applied Biosystems) z primerami RNA Dicer, Drosha lub 18s (Applied Biosystems), jak opisano wcześniej.15,16 Ostateczne poziomy mRNA przekształcono do stosunków o zmniejszonej ekspresji (.1) lub zwiększonej ekspresji (> 1) w stosunku do poziomu mRNA Dicer i Drosha w normalnym nabłonku jajnika. Analiza immunohistochemiczna
Szkiełka poddano deparafinizacji i ponownie uwodniono przy pomocy kolejnych płukań w ksylenie i etanolu. Odzyskiwanie antygenu przeprowadzono w szybkowarze w 90 ° C z użyciem roztworu Borg Decloaker (Biocare Medical). Preparaty następnie inkubowano z pierwszorzędowymi przeciwciałami przeciwko Dicer (rozcieńczenie 1: 100, Sigma) lub Drosha (1: 200, Abcam) przez noc, a następnie inkubowano z polimerem peroksydazy mysia-królik-chrzan (MR-HRP, Biocare Medical) i 3 Substrat 3 -diaminobenzydynowy (Phoenix Biotechnologies). Wybarwione szkiełka zostały ocenione przez dwóch badaczy, którzy nie byli świadomi wyników RT-PCR, na podstawie oceny histochemicznej (z wynikiem> 100 zdefiniowanym jako wysoka ekspresja i .100, niska ekspresja), zgodnie z metodą opisaną przez McCarty i wsp., 17,18, który uwzględnia zarówno intensywność zabarwienia, jak i procent zabarwionych komórek.
Uprawomocnienie
Związek między poziomami Dicer i mRNA Drosha i przeżywalności wśród pacjentów z rakiem jajnika (numer dostępu GEO, GSE314919), raka piersi (numer dostępu do ArrayExpress, E-TABM-15820 i numery dostępu GEO, GSE145621 i GSE492222) i raka płuc (Numer dostępu GEO, GSE314119) zbadano w istniejących zestawach danych dotyczących mikromacierzy próbek, które zostały sprofilowane za pomocą testu Affymetrix GeneChip (albo HG-U133A albo HG U133 Plus 2.0). Zestawy sondy 212888_at i 218269_at zostały użyte do pomiaru odpowiednio ekspresji Dicer i Drosha.
Mutacyjna analiza
Genomowy DNA wyekstrahowany z czterech linii komórek jajnika i 37 uprzednio zbadanych nowotworów jajnika zsekwencjonowano dla genu Dicer DICER1 (NM_177438) i eksonów kodujących geny Drosha RNASEN (NM_013235) i ich flankujące miejsca splicingowe w celu oceny potencjalnych mutacji, jak opisano wcześniej. Wszystkie warianty sekwencji zostały zweryfikowane poprzez ręczne sprawdzenie chromatogramów.
Transfekcja z małym interferującym i krótkim RNA o strukturze spinki do włosów
Oligonukleotyd anty-galektyna-3 (sekwencja docelowa, GTACAATCATCGGGTTAAATT, Dharmacon) i kontrolne nie kierujące oligonukleotydami (docelowa sekwencja, UUCUCCGAACGUGUCACGU; Qiagen) zastosowano do transfekcji siRNA i krótkiego spinki do włosów RNA (shRNA). ShRNA wytworzono przy użyciu wektora przeniesienia genu lentiwirusa (zawierającego zielone białko fluorescencyjne), jak opisano wcześniej24; shRNA indukuje stabilne wyciszanie genetyczne.
Do transfekcji siRNA i shRNA wysiano 2 x 105 komórek na studzienkę i dodano 5 .g siRNA galektyny-3 lub kierowania nie kierującego zgodnie z protokołem producenta. Transfekcję uznano za udaną, jeśli osiągnięto stopień transfekcji powyżej 90%. Wyciszanie genów oceniano za pomocą analizy Western blot.
Analiza statystyczna
Aby określić rozkład poziomów Dicer i Drosha wokół punktów odcięcia, histogramy zostały utworzone w skali log2 współczynnika ekspresji i przetestowane pod kątem normalności w teście Kołmogorowa-Smirnowa
[podobne: choligrip syrop, belara tabletki antykoncepcyjne cena, asertin skutki uboczne ]

Powiązane tematy z artykułem: asertin skutki uboczne belara tabletki antykoncepcyjne cena choligrip syrop